Programming exercise

Calculate the reverse complement of a DNA sequence

Today you will write a simple computer program that accepts a DNA sequence and calculates its reverse complement.

You will need to download the Python software package.

Once installed, run the "IDLE" command. Select "File->New Window". You will write your program in this new window and run it by selecting "Run->Run Module".

Calculate the reverse complement of this sequence:

ATCGACTGACGTAGTCAGTAGTCGTACGTCAGTCAGTGTCAGTG

Your program should produce the following output:

CACTGACACTGACTGACGTACGACTACTGACTACGTCAGTCGAT

When you are satisfied that your program works correctly, print it out and hand it in.