Real Time PCR

2010

---

Back to Lab Schedule

• 94 C for 10 min. (Denatures your sample)

• 94 C for 10 sec. (Denatures Sample)
• 50 C for 20 sec (Anneals Primer)
• 72 C for 1 min. 20 sec (Extension of Primer)
• 78 C for 1 sec
• plate read for double stranded DNA
• 80 C for 1 sec
• plate read for double stranded DNA
• 82 C for 1 sec
• plate read for double stranded DNA
• 84 C for 1 sec
• plate read
• 86 C for 1 sec
• plate read(There are many plate reads- you will choose only one of them to use to analyze your data based on how your DNA melts and how your primer dimers melt)
Then 1 x
• 72 C for 10 min to make sure PCR complete
• Melting Curve -- readings every 0.2 C from 65 C to 95 C (Used to determine which plate read to use to analyze your sample, and sample integrity)
• 72 C for 10 min to renature so you can run them on a gel next time if you wish
• Room Temp Forever  

SET-UP INFORMATION (You must look through this before you come to class!)

• We are going to set up a method to quantitate how much RBCL DNA you have in each of your different plant tissues compared to one another. We will take 100 ng of DNA from each plant tissue and look to see relative to other plant tissues how much RBCL is amplified in real-time PCR. All reactions will be performed in duplicate.

• Real-Time PCR primers tend to work best when you amplify only small regions of DNA. The primers I have choosen are from a list of universal primers for RUBISCO - universal means that they were designed to bind to regions of DNA that have very high consensus among different species of plants. Even though the primers were designed to amplify most plant species To look at primers for RBCL check out this table to see the positions of some of these primers in several different plants: http://bfw.ac.at/200/2043.html You will also notice that some of the primers do have a few plant species they don't work in. We are going to try primer set B but I do have a few other choices of different primer sets including A that might work better if your trying to amplify DNA from a more unusual plant.

A. rbcl2f ( called RbclReiseberg on linked page) and RBCL-fonfana will give you a fragment that is about 500 bp

 

B. rbcl2F (called RbclReiseberg on linked page-atgtcaccacaaacagaaactaagcaagt) and RBCL-Savolainen (tacagttgtccatgtaccag) will give you about a 200 bp fragment

• You will have 16 tubes for your PCR reaction but they will not be lableled except by number and letter, 1A-1H and 2A-2H. One should contain a No DNA control (all of the ingrediants for PCR but water instead of DNA from a plant sample). We will also be setting up reactions containing a plasmid containing the RBCL gene at different concentrations as a class. Ultimately, you can use the positive control plasmids to determine from the real-time experiment exactly how many ug of RBCL DNA you have.

Experimental

1. First Step: Find your DNA concentrations. The first person to nanodrop needs to get some water, TE, and a 2 ul pipette, tips and your DNA samples completely mixed. If you had a large pellet you will probably want to dilute the samples 1 to 10 before nanodropping. As you wait for the nanodrop- determine how you will organize your samples among the 16 lanes by beginning to fill out Table 1 below. This chart is explained more completely in further sections. You should have two trials for each of your samples and in one of your tubes you should have a no DNA sample in which you use water instead of DNA. Once you get to the nanodrop you can fill in your concentrations and purities.

2. Once you have your concentration. The second step will be to determine how much of each DNA to put into a PCR tube. We are going to be doing 20 ul reactions and with all of the other ingrediants, there is room to put only 8.4 ul of DNA into each tube. If possible I would like you to have 100 ng of DNA in each PCR tube. Many times your concentrations are so large that you would only have to pippette 0.1 ul of DNA ot make 100 ng. If this is the case you would need to do a dlution. Just for your info I filled out the chart and determined that if you diluted your concentration to 11.9 ng/ul, then you would use 8.4 ul of sample to give you 100 ng ie 11.9 ng/ul *8.4 ul -= 99.6 ng. You can dilute to whatever concentration you want as long as you don't use more than 8.4 ul to get 100 ng of sample. If you use less than 8.4 ul you will need to replace the rest of that volume with water to make a total of 8.4 ul.

Table 1 - DNA Concentrations

Name of Sample to be used/
 number of ug 
         

Concentration of
Orignal

3. To avoid a lot of pippetting when you do PCR you set up a master mix. This mix will contain the sybr green dye, Taq, nucleoties and buffer that you need for your PCR( all this comes premixed from BIORAD and is called PCR Supermix) and your two primers which were ordered from a company called Integrated DNA Technologies. I tell that company the sequence I want the primer to be and they make it and send it to me. It costs 25 cents a base to make enough primer to do these reactions in about 2 years of classes. As you can see below for a 20 ul reaction, 11.6 ul will be your Master Mix and 8.4 ul will be the DNA from above to make 20 ul total. Make sure you understand the calculations on the chart below and how I got them for the ul to use for a single reaction.

Table 2- Making the Mastermix.

Concentration of Ingrediants Needed	Stock Concentration you have Available	ul to use in one 20 ul reaction	Number of PCR Reactions you are setting up	ul to use for making Master Mix
1 x reaction buffer	2 x PCR Supermix	10 ul	.	.
1.28 pmol/ul	32 uM forward primer	0.8 ul	.	.
1.28 pmol/ul	32 uM reverse primer	0.8 ul	.	.
.	Total	11. 6 ul	.	.

4. After you finish filling your charts out - check with your lab instructor before continuing. Once your dilutions are approved please begin making them up.

5..Label your two strips of tubes so you know which is which. Make your master mix. Make sure you vortex and spin down master mix and all of the ingrediants that make it up before you pippette them to ensure they are well-mixed up. Place 11.6 ul of master mix into each tube. Make sure you pipette the mix to the bottom of the tube as I don't have any way of spinning these strips. Keep strips on ice as much as possible.

 6. Place the appropriate amount of DNA and water in each tube. Pipette into the liquid already in the tube. Use careful pipetting and mix up and down while pipetting.

 5. Keep your samples on ice until we are ready to load the machine. Once they are loaded I will talk to you more about what real-time PCR is specifically compared to PCR.