Final
Exam – Take Home
Genomics,
BIO 427, spring 2007, Monroe and Temple
You must work alone on this exam. You may use your lab notebook,
internet or published resources but you must cite all sources you use.
Refer to all citations (papers and URLs) in the text using
parenthetical, sequential numbers [e.g. (1), (2)] and list full
citations at the end in order of their use. Please turn in a
typed (double-spaced, 12-point font) response by 1:30 PM, Thursday, May
3, 2007.
I have not received any assistance in completing this exam.
Name printed: __________________ Name signed:
___________________
For questions 1-5 refer to Heuer et al.,
(2004) The complete sequences of plasmids pB2 and pB3 provide evidence
for a recent ancestor of the IncP-1β group without any ancestral genes,
Microbiology 150: 3591-3599.
1. Near the top of the map of pB3 (Figure 1) are the genes tfrA and
ssb. What roles do these genes/proteins play in the maintenance
of the plasmid?
2. What is the RefSeq number for this version of ssb? Using this
sequence and the human mitochondrial ssb structure (2DUD) as a starting
point, describe this gene family. Include in your response in
which types of organisms the homologous sequences can be found, how
similar they are (percent identity and 3D structure). Include in your
answer an alignment and your thoughts on the relative degree of
conservation of this protein family. Use examples.
3. In the methods section is the following line: “Standard shotgun
sequencing reactions using the dye-terminator were separated on an ABI
3700 (Applied Biosystems) DNA sequencer, resulting in 825 and 892
sequencing reads with 589 and 578 bases mean sequence length for pB2
and pB3, respectively.” Explain what this means in your own words.
4. Why do environmental plasmids often contain resistance or
degradation genes in addition to genes required for replication and
horizontal transfer? What evidence suggests that plasmids without
these mobile elements exist in nature? What might account for the
fact that none have been discovered so far?
5. In Figure 2, why does the incC2 tree place plasmid pB10 in different
relationship, compared to all the other trees? On what do the
authors based their conclusion that plasmid pB3 and the R751 group of
plasmids derived from a common ancestor? Why might mobile DNA
elements affect phylogenetic analyses?
6. Consider the following raw sequence from our plasmid-sequencing
project. Which primer was probably used to obtain this
sequence? Underline the vector sequence(s).
GCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCAGGTCGTAGATGTTG
CGCTCGCGCTCGCTGAGGGCGGCCTTGCTGCCCTTCTGCATGGTCGGCACGATGCCGTGG
TGCGCGGTGATCTTCGAGTCGTCCCACGTCTTGGACTTGATACGCGGATCCCCCGGGCTG
CAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAA
TTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGA
CTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAG
7a. Consider the following partial alignment of three homologous
fictitious proteins. Describe two reasons that could explain why
the first two sequences are more similar to each other than either is
to the third.
YQCATNANSQLRQD
YQNATHANMQNRQE
INCGTSAKMELPYE
* *
7b. Notice that two amino acids (*) are conserved in all three
sequences and the one between those two is not conserved. If
these three amino acids are located in an alpha helix on the surface of
the protein, what could you conclude about the orientation of the three
R-groups? Please explain.
8. The following sequence is one of the shorter contigs from pJMY that
we didn't analyze last week. Find a
gene that is encoded in this contig and identify it by
several possible protein
names. Which direction is the gene encoded?
AACGGCAAGATGAGCTGCGGGTATGCCTGCTGCAACGTCGCCAGGTTGTTGACGTGGCGCGG
CTTCCGCGCGTCCACCTTGTTCGGCACCATGCCGAGGAAGCGCAGCTTGGGGTTCTGCTTGC
GCAGGTTGCTGATGACCGCGACCATCTTCTTCATGCCCTGCAAGCTGTACGCCTCCATTTCG
ATGGGCGACAGCATGTAGTCGGCCGTCAGCACGGCCGCCGTCATGGCGACGCCAAGGGAGGG
GGCCGTGTCGATCAGGCACACGTCGAAGAACTCGCCCAGCGCGGCCACACTGGCCCGCAGCG
CGGCGGCCGCCTGGGAAAGCTCCATCTTGTCCAGGTTCGCCAGGTTGGCGTCTGCCGCGATC
AGCGCCAGGCTCTCGCCCTCGCGCTTGCCGAACCAATACCGCAGGTCATCGGTGTCGCCGGT
GAACAACTGGCTGGCGAGGTAGCCCGATTGGTACGCCGACAGCGTGAACGATGCGTTGCCCT
GGGTGTCCAGGTCGATCACGGCCACGCGAAGGCCGCGCTCCAGGAAGTCGAATGCCA
Have a great summer!