Final Exam – Take Home

Genomics, BIO 427, spring 2007, Monroe and Temple


You must work alone on this exam.  You may use your lab notebook, internet or published resources but you must cite all sources you use. Refer to all citations (papers and URLs) in the text using parenthetical, sequential numbers [e.g. (1), (2)] and list full citations at the end in order of their use.  Please turn in a typed (double-spaced, 12-point font) response by 1:30 PM, Thursday, May 3, 2007.


I have not received any assistance in completing this exam.

Name printed: __________________    Name signed: ___________________


For questions 1-5 refer to Heuer et al., (2004) The complete sequences of plasmids pB2 and pB3 provide evidence for a recent ancestor of the IncP-1β group without any ancestral genes, Microbiology 150: 3591-3599.

1. Near the top of the map of pB3 (Figure 1) are the genes tfrA and ssb.  What roles do these genes/proteins play in the maintenance of the plasmid? 

2. What is the RefSeq number for this version of ssb?  Using this sequence and the human mitochondrial ssb structure (2DUD) as a starting point, describe this gene family.  Include in your response in which types of organisms the homologous sequences can be found, how similar they are (percent identity and 3D structure). Include in your answer an alignment and your thoughts on the relative degree of conservation of this protein family.  Use examples.

3. In the methods section is the following line: “Standard shotgun sequencing reactions using the dye-terminator were separated on an ABI 3700 (Applied Biosystems) DNA sequencer, resulting in 825 and 892 sequencing reads with 589 and 578 bases mean sequence length for pB2 and pB3, respectively.”  Explain what this means in your own words.

4. Why do environmental plasmids often contain resistance or degradation genes in addition to genes required for replication and horizontal transfer?  What evidence suggests that plasmids without these mobile elements exist in nature?  What might account for the fact that none have been discovered so far?

5. In Figure 2, why does the incC2 tree place plasmid pB10 in different relationship, compared to all the other trees?  On what do the authors based their conclusion that plasmid pB3 and the R751 group of plasmids derived from a common ancestor?  Why might mobile DNA elements affect phylogenetic analyses?

6. Consider the following raw sequence from our plasmid-sequencing project.  Which primer was probably used to obtain this sequence?  Underline the vector sequence(s).

GCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCAGGTCGTAGATGTTG
CGCTCGCGCTCGCTGAGGGCGGCCTTGCTGCCCTTCTGCATGGTCGGCACGATGCCGTGG
TGCGCGGTGATCTTCGAGTCGTCCCACGTCTTGGACTTGATACGCGGATCCCCCGGGCTG
CAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCAA
TTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGA
CTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAG


7a. Consider the following partial alignment of three homologous fictitious proteins.  Describe two reasons that could explain why the first two sequences are more similar to each other than either is to the third.

               YQCATNANSQLRQD
               YQNATHANMQNRQE

              
INCGTSAKMELPYE

                  
* *
                             
7b. Notice that two amino acids (*) are conserved in all three sequences and the one between those two is not conserved.  If these three amino acids are located in an alpha helix on the surface of the protein, what could you conclude about the orientation of the three R-groups? Please explain.

8. The following sequence is one of the shorter contigs from pJMY that we didn't analyze last week.  Find a gene that is encoded in this contig and identify it by several possible protein names.  Which direction is the gene encoded?

AACGGCAAGATGAGCTGCGGGTATGCCTGCTGCAACGTCGCCAGGTTGTTGACGTGGCGCGG
CTTCCGCGCGTCCACCTTGTTCGGCACCATGCCGAGGAAGCGCAGCTTGGGGTTCTGCTTGC
GCAGGTTGCTGATGACCGCGACCATCTTCTTCATGCCCTGCAAGCTGTACGCCTCCATTTCG
ATGGGCGACAGCATGTAGTCGGCCGTCAGCACGGCCGCCGTCATGGCGACGCCAAGGGAGGG
GGCCGTGTCGATCAGGCACACGTCGAAGAACTCGCCCAGCGCGGCCACACTGGCCCGCAGCG
CGGCGGCCGCCTGGGAAAGCTCCATCTTGTCCAGGTTCGCCAGGTTGGCGTCTGCCGCGATC
AGCGCCAGGCTCTCGCCCTCGCGCTTGCCGAACCAATACCGCAGGTCATCGGTGTCGCCGGT
GAACAACTGGCTGGCGAGGTAGCCCGATTGGTACGCCGACAGCGTGAACGATGCGTTGCCCT
GGGTGTCCAGGTCGATCACGGCCACGCGAAGGCCGCGCTCCAGGAAGTCGAATGCCA


Have a great summer!